|
Santa Cruz Biotechnology
goat polyclonal anti wave2 Goat Polyclonal Anti Wave2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat polyclonal anti wave2/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
goat polyclonal anti wave2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
goat anti-abi2 Goat Anti Abi2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat anti-abi2/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
goat anti-abi2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
goat anti wave2 polyclonal antibody ![]() Goat Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
goat anti wave2 polyclonal antibody - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
goat polyclonal anti-human wave2 antibody ![]() Goat Polyclonal Anti Human Wave2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat polyclonal anti-human wave2 antibody/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
goat polyclonal anti-human wave2 antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
wave2 1 † aaaccagauccucuuugguugucca uuuggucuaggagaaaccaacaggu Wave2 1 † Aaaccagauccucuuugguugucca Uuuggucuaggagaaaccaacaggu, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 1 † aaaccagauccucuuugguugucca uuuggucuaggagaaaccaacaggu/product/Millipore Average 90 stars, based on 1 article reviews
wave2 1 † aaaccagauccucuuugguugucca uuuggucuaggagaaaccaacaggu - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
wave2 rabbit primary antibody Wave2 Rabbit Primary Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 rabbit primary antibody/product/Cell Signaling Technology Inc Average 95 stars, based on 1 article reviews
wave2 rabbit primary antibody - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
target sirna antibody for detection of protein n wasp ![]() Target Sirna Antibody For Detection Of Protein N Wasp, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/target sirna antibody for detection of protein n wasp/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
target sirna antibody for detection of protein n wasp - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
target sirna ![]() Target Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/target sirna/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
target sirna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Abnova
goat anti-arpc1a ![]() Goat Anti Arpc1a, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat anti-arpc1a/product/Abnova Average 90 stars, based on 1 article reviews
goat anti-arpc1a - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Biodesign International Inc
anti-gapdh ![]() Anti Gapdh, supplied by Biodesign International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-gapdh/product/Biodesign International Inc Average 90 stars, based on 1 article reviews
anti-gapdh - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
anti-phosphotyrosine (pty) 4g10 ![]() Anti Phosphotyrosine (Pty) 4g10, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-phosphotyrosine (pty) 4g10/product/Millipore Average 90 stars, based on 1 article reviews
anti-phosphotyrosine (pty) 4g10 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Millipore
mouse anti-actin antibody jla20 ![]() Mouse Anti Actin Antibody Jla20, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse anti-actin antibody jla20/product/Millipore Average 90 stars, based on 1 article reviews
mouse anti-actin antibody jla20 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Biological Chemistry
Article Title: Dysbindin-1C Is Required for the Survival of Hilar Mossy Cells and the Maturation of Adult Newborn Neurons in Dentate Gyrus
doi: 10.1074/jbc.m114.590927
Figure Lengend Snippet: FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Article Snippet: Other antibodies used in this study were as follows:
Techniques: Expressing, SDS Page, Western Blot, Negative Control, Control, Membrane, Fractionation, Marker, Sedimentation, Mutagenesis
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz,
Techniques:
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.
Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz,
Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Article Snippet: Table 1 Target siRNA Antibody for detection of
Techniques:
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.
Article Snippet: Table 1 Target siRNA Antibody for detection of
Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Article Snippet:
Techniques: Control
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.
Article Snippet:
Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing, Control